Exercise D: linear mixed model¶
Part 2: Binary traits¶
Charcot-Marie-Tooth Disease (CMT) is a group of inherited peripheral neuropathies characterized by progressive muscle weakness, atrophy, and sensory loss, primarily in the distal limbs. It is one of the most common inherited neurological disorders, affecting approximately 1 in 2,500 people. Symptoms often begin in adolescence or early adulthood and may include foot deformities, gait abnormalities, and reduced reflexes.
Below you will apply a method called regenie that implemented linear mixed model for GWAS.
# create the output folder for storing output files
if [ ! -d ./output ]; then
mkdir ./output
fi
Step0: Format the data as needed¶
head /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt
FID IID phenotype 1000022 1000022 0 1000035 1000035 0 1000046 1000046 0 1000054 1000054 0 1000063 1000063 0 1000078 1000078 0 1000105 1000105 0 1000141 1000141 0 1000164 1000164 0
Step1: fitting the null linear mixed model with regenie¶
For quantitative traits (such as standing height), regenie fits a linear mixed model by default.
It is recommended to inverse normalize the phenotype before analysis to improve normality and statistical power.
# # do not run!
# # running about 2.5 hours
# source /home/student/miniconda3/bin/activate regenie_env
# regenie \
# --step 1 \
# --bed /home/student/USER/GWAS/data/ukb23150_c1_c22_2024_WES_1826_QCpruned \
# --phenoFile /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt \
# --bt \
# --strict \
# --firth --approx \
# --bsize 1000 \
# --loocv \
# --lowmem \
# --lowmem-prefix ./output/regenie_tmp_preds_WES \
# --write-null-firth \
# --out ./output/regenie_step1_WO_PC20_WES
# conda deactivate
# files .loco is the output with the per-chromosome LOCO predictions as rows of the files
head -n 22 /home/student/USER/GWAS/data/regenie_step1_WES_1.loco |
awk '{print $1,$2,$3,$4,$5,$6,$7,$8,$9}' | column -t
See more parameter explanations: https://rgcgithub.github.io/regenie/options/.
The estimates for approximate Firth under the null will be written to file .firth and the list of these files is written to file_firth.list. This can be used in step 2 as --use-null-firth file_firth.list.
cat /home/student/USER/GWAS/data/regenie_step1_WES_1.firth
1 -112.731 2 -112.474 3 -112.817 4 -113.042 5 -112.696 6 -113.191 7 -113.136 8 -113.058 9 -113.423 10 -113.426 11 -112.942 12 -112.698 13 -113.495 14 -113.547 15 -113.537 16 -113.307 17 -112.475 18 -113.726 19 -112.309 20 -113.734 21 -113.782 22 -113.115 23 -113.817
Step 2: performing single-variant association tests¶
For quantitative traits (such as standing height), regenie automatically uses a linear mixed model for association testing.
There is no need for saddle point approximation or Firth correction, as these are specific to binary traits.
The output will include effect sizes, standard errors, and p-values for each variant.
# running about 0.5 minutes
source /home/student/miniconda3/bin/activate regenie_env
regenie \
--step 2 \
--bed /home/student/USER/GWAS/data/ukb23150_c1_c22_2024_WES_1826_QCpruned \
--ref-first \
--phenoFile /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt \
--bt \
--strict \
--bsize 1000 \
--firth --approx \
--pThresh 0.01 \
--pred /home/student/USER/GWAS/data/regenie_step1_WES_pred.list \
--use-null-firth /home/student/USER/GWAS/data/regenie_step1_WES_firth.list \
--out ./output/regenie_step2_asso_WES
conda deactivate
(regenie_env) Start time: Tue Jul 22 22:19:30 2025
|===========================|
| REGENIE v4.1.gz |
|===========================|
Copyright (c) 2020-2024 Joelle Mbatchou, Andrey Ziyatdinov and Jonathan Marchini.
Distributed under the MIT License.
Compiled with Boost Iostream library.
Using Intel MKL with Eigen.
Log of output saved in file : ./output/regenie_step2_asso_WES.log
Options in effect:
--step 2 \
--bed /home/student/USER/GWAS/data/ukb23150_c1_c22_2024_WES_1826_QCpruned \
--ref-first \
--phenoFile /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt \
--bt \
--strict \
--bsize 1000 \
--firth \
--approx \
--pThresh 0.01 \
--pred /home/student/USER/GWAS/data/regenie_step1_WES_pred.list \
--use-null-firth /home/student/USER/GWAS/data/regenie_step1_WES_firth.list \
--out ./output/regenie_step2_asso_WES
Association testing mode with fast multithreading using OpenMP
* bim : [/home/student/USER/GWAS/data/ukb23150_c1_c22_2024_WES_1826_QCpruned.bim] n_snps = 209257
* fam : [/home/student/USER/GWAS/data/ukb23150_c1_c22_2024_WES_1826_QCpruned.fam] n_samples = 1826
* bed : [/home/student/USER/GWAS/data/ukb23150_c1_c22_2024_WES_1826_QCpruned.bed]
* phenotypes : [/home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt] n_pheno = 1
-dropping observations with missing values at any of the phenotypes
-number of phenotyped individuals with no missing data = 1826
* number of individuals used in analysis = 1826
* case-control counts for each trait:
- 'phenotype': 166 cases and 1660 controls
* LOCO predictions : [/home/student/USER/GWAS/data/regenie_step1_WES_pred.list]
-file [/home/student/USER/GWAS/data/regenie_step1_WES_1.loco] for phenotype 'phenotype'
* # threads : [31]
* block size : [1000]
* # blocks : [220]
* reading null Firth estimates using file : [/home/student/USER/GWAS/data/regenie_step1_WES_firth.list]
* approximate memory usage : 79MB
* using minimum MAC of 5 (variants with lower MAC are ignored)
* using fast Firth correction for logistic/cox regression p-values less than 0.01
Chromosome 1 [22 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (34ms)
block [1/220] : done (7ms)
block [2/220] : done (2ms)
block [3/220] : done (2ms)
block [4/220] : done (2ms)
block [5/220] : done (2ms)
block [6/220] : done (2ms)
block [7/220] : done (6ms)
block [8/220] : done (9ms)
block [9/220] : done (9ms)
block [10/220] : done (9ms)
block [11/220] : done (2ms)
block [12/220] : done (2ms)
block [13/220] : done (2ms)
block [14/220] : done (2ms)
block [15/220] : done (2ms)
block [16/220] : done (2ms)
block [17/220] : done (2ms)
block [18/220] : done (2ms)
block [19/220] : done (2ms)
block [20/220] : done (2ms)
block [21/220] : done (2ms)
block [22/220] : done (0ms)
Chromosome 2 [15 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [23/220] : done (2ms)
block [24/220] : done (2ms)
block [25/220] : done (2ms)
block [26/220] : done (2ms)
block [27/220] : done (2ms)
block [28/220] : done (2ms)
block [29/220] : done (2ms)
block [30/220] : done (2ms)
block [31/220] : done (2ms)
block [32/220] : done (2ms)
block [33/220] : done (2ms)
block [34/220] : done (2ms)
block [35/220] : done (2ms)
block [36/220] : done (2ms)
block [37/220] : done (1ms)
Chromosome 3 [12 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [38/220] : done (2ms)
block [39/220] : done (2ms)
block [40/220] : done (2ms)
block [41/220] : done (2ms)
block [42/220] : done (2ms)
block [43/220] : done (2ms)
block [44/220] : done (2ms)
block [45/220] : done (2ms)
block [46/220] : done (7ms)
block [47/220] : done (9ms)
block [48/220] : done (9ms)
block [49/220] : done (4ms)
Chromosome 4 [9 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [50/220] : done (2ms)
block [51/220] : done (2ms)
block [52/220] : done (2ms)
block [53/220] : done (2ms)
block [54/220] : done (2ms)
block [55/220] : done (2ms)
block [56/220] : done (2ms)
block [57/220] : done (2ms)
block [58/220] : done (1ms)
Chromosome 5 [10 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [59/220] : done (2ms)
block [60/220] : done (2ms)
block [61/220] : done (2ms)
block [62/220] : done (2ms)
block [63/220] : done (2ms)
block [64/220] : done (2ms)
block [65/220] : done (2ms)
block [66/220] : done (2ms)
block [67/220] : done (2ms)
block [68/220] : done (1ms)
Chromosome 6 [13 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [69/220] : done (2ms)
block [70/220] : done (2ms)
block [71/220] : done (2ms)
block [72/220] : done (2ms)
block [73/220] : done (2ms)
block [74/220] : done (2ms)
block [75/220] : done (2ms)
block [76/220] : done (2ms)
block [77/220] : done (2ms)
block [78/220] : done (2ms)
block [79/220] : done (2ms)
block [80/220] : done (2ms)
block [81/220] : done (0ms)
Chromosome 7 [11 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [82/220] : done (2ms)
block [83/220] : done (2ms)
block [84/220] : done (2ms)
block [85/220] : done (2ms)
block [86/220] : done (2ms)
block [87/220] : done (2ms)
block [88/220] : done (2ms)
block [89/220] : done (2ms)
block [90/220] : done (2ms)
block [91/220] : done (2ms)
block [92/220] : done (0ms)
Chromosome 8 [8 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [93/220] : done (2ms)
block [94/220] : done (2ms)
block [95/220] : done (2ms)
block [96/220] : done (2ms)
block [97/220] : done (2ms)
block [98/220] : done (2ms)
block [99/220] : done (2ms)
block [100/220] : done (1ms)
Chromosome 9 [10 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [101/220] : done (2ms)
block [102/220] : done (2ms)
block [103/220] : done (2ms)
block [104/220] : done (2ms)
block [105/220] : done (2ms)
block [106/220] : done (2ms)
block [107/220] : done (2ms)
block [108/220] : done (2ms)
block [109/220] : done (2ms)
block [110/220] : done (0ms)
Chromosome 10 [10 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [111/220] : done (2ms)
block [112/220] : done (2ms)
block [113/220] : done (2ms)
block [114/220] : done (2ms)
block [115/220] : done (2ms)
block [116/220] : done (2ms)
block [117/220] : done (2ms)
block [118/220] : done (2ms)
block [119/220] : done (2ms)
block [120/220] : done (0ms)
Chromosome 11 [13 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [121/220] : done (2ms)
block [122/220] : done (2ms)
block [123/220] : done (2ms)
block [124/220] : done (2ms)
block [125/220] : done (2ms)
block [126/220] : done (2ms)
block [127/220] : done (2ms)
block [128/220] : done (2ms)
block [129/220] : done (2ms)
block [130/220] : done (2ms)
block [131/220] : done (2ms)
block [132/220] : done (2ms)
block [133/220] : done (1ms)
Chromosome 12 [12 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [134/220] : done (2ms)
block [135/220] : done (2ms)
block [136/220] : done (2ms)
block [137/220] : done (2ms)
block [138/220] : done (2ms)
block [139/220] : done (2ms)
block [140/220] : done (2ms)
block [141/220] : done (2ms)
block [142/220] : done (2ms)
block [143/220] : done (2ms)
block [144/220] : done (2ms)
block [145/220] : done (0ms)
Chromosome 13 [4 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [146/220] : done (2ms)
block [147/220] : done (2ms)
block [148/220] : done (2ms)
block [149/220] : done (1ms)
Chromosome 14 [7 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [150/220] : done (2ms)
block [151/220] : done (2ms)
block [152/220] : done (2ms)
block [153/220] : done (2ms)
block [154/220] : done (2ms)
block [155/220] : done (2ms)
block [156/220] : done (1ms)
Chromosome 15 [7 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [157/220] : done (2ms)
block [158/220] : done (2ms)
block [159/220] : done (2ms)
block [160/220] : done (2ms)
block [161/220] : done (2ms)
block [162/220] : done (2ms)
block [163/220] : done (2ms)
Chromosome 16 [10 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [164/220] : done (2ms)
block [165/220] : done (2ms)
block [166/220] : done (2ms)
block [167/220] : done (2ms)
block [168/220] : done (2ms)
block [169/220] : done (2ms)
block [170/220] : done (2ms)
block [171/220] : done (2ms)
block [172/220] : done (2ms)
block [173/220] : done (6ms)
Chromosome 17 [12 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [174/220] : done (8ms)
block [175/220] : done (9ms)
block [176/220] : done (9ms)
block [177/220] : done (3ms)
block [178/220] : done (2ms)
block [179/220] : done (2ms)
block [180/220] : done (2ms)
block [181/220] : done (2ms)
block [182/220] : done (2ms)
block [183/220] : done (2ms)
block [184/220] : done (2ms)
block [185/220] : done (2ms)
Chromosome 18 [4 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [186/220] : done (2ms)
block [187/220] : done (2ms)
block [188/220] : done (2ms)
block [189/220] : done (1ms)
Chromosome 19 [16 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [190/220] : done (2ms)
block [191/220] : done (2ms)
block [192/220] : done (2ms)
block [193/220] : done (2ms)
block [194/220] : done (2ms)
block [195/220] : done (2ms)
block [196/220] : done (2ms)
block [197/220] : done (2ms)
block [198/220] : done (2ms)
block [199/220] : done (2ms)
block [200/220] : done (2ms)
block [201/220] : done (2ms)
block [202/220] : done (2ms)
block [203/220] : done (2ms)
block [204/220] : done (2ms)
block [205/220] : done (1ms)
Chromosome 20 [6 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [206/220] : done (2ms)
block [207/220] : done (2ms)
block [208/220] : done (2ms)
block [209/220] : done (2ms)
block [210/220] : done (2ms)
block [211/220] : done (1ms)
Chromosome 21 [3 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [212/220] : done (2ms)
block [213/220] : done (2ms)
block [214/220] : done (1ms)
Chromosome 22 [6 blocks in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (0ms)
block [215/220] : done (2ms)
block [216/220] : done (2ms)
block [217/220] : done (2ms)
block [218/220] : done (2ms)
block [219/220] : done (2ms)
block [220/220] : done (0ms)
Association results stored separately for each trait in files :
* [./output/regenie_step2_asso_WES_phenotype.regenie]
Number of tests with Firth correction : 2109
Number of failed tests : (0/2109)
Number of ignored tests due to low MAC : 0
Elapsed time : 0.921328s
End time: Tue Jul 22 22:19:31 2025
(regenie_env)
View the result of REGENIE-GWAS¶
head ./output/regenie_step2_asso_WES_phenotype.regenie | column -t
CHROM GENPOS ID ALLELE0 ALLELE1 A1FREQ N TEST BETA SE CHISQ LOG10P EXTRA 1 931131 1:931131:C:CCCCT C CCCCT 0.749304 1795 ADD 0.0879027 0.143134 0.377154 0.268306 NA 1 935954 1:935954:G:T G T 0.713151 1825 ADD -0.0556126 0.132389 0.176459 0.171061 NA 1 941119 1:941119:A:G A G 0.9477 1826 ADD 0.0558923 0.283422 0.0388898 0.0738289 NA 1 942335 1:942335:C:G C G 0.936534 1812 ADD 0.0583145 0.255568 0.0520641 0.0864458 NA 1 942934 1:942934:G:C C G 0.902793 1826 ADD -0.223612 0.201524 1.23123 0.573215 NA 1 942951 1:942951:C:T T C 0.978094 1826 ADD 0.489697 0.405544 1.45807 0.643521 NA 1 943404 1:943404:C:G G C 0.987678 1826 ADD 0.415825 0.487273 0.728243 0.405107 NA 1 943429 1:943429:C:T T C 0.992603 1825 ADD -1.13066 0.678929 2.7734 1.01844 NA 1 943645 1:943645:C:G G C 0.992059 1826 ADD -0.934967 0.650255 2.0674 0.822528 NA
# search for the most significant SNP
awk 'NR>1 {print $1,$2,$3,$12}' \
./output/regenie_step2_asso_WES_phenotype.regenie | sort -k4,4gr 2>/dev/null | head -1 || true
4 70244771 4:70244771:C:T 6.46158
# Prepare for plotting the results
options(warn = -1)
suppressPackageStartupMessages({
library(magrittr)
})
regenie_results= data.table::fread("./output/regenie_step2_asso_WES_phenotype.regenie")
regenie_results[, P := 10^(-LOG10P)] %>%
data.table::setnames(
c("CHROM", "GENPOS", "ID"),
c("CHR", "BP", "SNP")
)
regenie_results %>%
data.table::fwrite("./output/regenie_step2_asso_WES_phenotype_v2.regenie")
# running about 0.5 minutes
options(repr.plot.width = 16,
repr.plot.height = 4,
repr.plot.res = 600)
source("/home/student/USER/GWAS/data/plotPlink.R")
# plot the results (.regenie is the output file from regenie)
plots= plot_qqman(
plink_assoc_file= "./output/regenie_step2_asso_WES_phenotype_v2.regenie",
pheno_name= "CMT",
save_plot = FALSE,
lambda1_qq_pos = c(1.48, -5.5),
lambda2_qq_pos = c(1.1, -4)
)
print(plots$manhattan_plot)
# running about 0.5 minutes
options(repr.plot.width = 4.1,
repr.plot.height = 4.1,
repr.plot.res = 600)
print(plots$qq_plot)
Exercise E : Gene-based testing¶
Instead of performing single-variant association tests, multiple variants can be aggregated in a given region, such as a gene.
This can be especially helpful when testing rare variants as single-vatiant tests usuaally have lower power performance.
To avoid inflation in the gene-based tets due to rare variants as well as reduce computation time, we can implement the collapsing approach of gene-based testing proposed in SAIGE-GENE+, where ultra-rare variants are aggregated into a mask.
Annotation input files: to define variant sets and functional annotations which will be used to generate masks.¶
Each line contains the variant name, the set/gene name and a single annotation category (space/tab separated).
Variants not in this file will be assigned to a default "NULL" category. A maximum of 63 annotation categories (+NULL category) is allowed.
To obtain a single annotation per gene, we could choose the most deleterious functional annotation across the gene transcripts or alternatively use the canonical transcript (note that its definition can vary across software).
head /home/student/USER/GWAS/data/regenie_WES_anno_file.txt | column -t
22:15528067:C:T OR11H1 MODIFIER 22:15528094:A:G OR11H1 MODIFIER 22:15528096:G:A OR11H1 MODIFIER 22:15528109:T:G OR11H1 MODIFIER 22:15528133:A:G OR11H1 MODIFIER 22:15528155:G:A OR11H1 MODIFIER 22:15528165:C:A OR11H1 MODIFIER 22:15528166:C:T OR11H1 MODIFIER 22:15528177:C:T OR11H1 MODIFIER 22:15528179:G:T OR11H1 MODIFIER
Set list file: to list variants within each set/gene to use when building masks.¶
Each line contains the set/gene name followed by a chromosome and physical position for the set/gene, then by a comma-separated list of variants included in the set/gene.
head -n 1 /home/student/USER/GWAS/data/regenie_WES_set_list_CHR_POS.txt | column -t
A4GALT 22 42692793 22:42692793:C:G,22:42692793:C:T,22:42692794:G:A,22:42692794:G:C,22:42692795:G:A,22:42692808:C:G,22:42692808:C:T,22:42692809:G:A,22:42692810:G:A,22:42692822:T:C,22:42692822:T:G,22:42692826:T:A,22:42692827:C:T,22:42692828:C:T,22:42692830:C:G,22:42692830:C:T,22:42692831:G:A,22:42692835:A:T,22:42692837:G:A,22:42692838:G:A,22:42692839:C:T,22:42692840:G:A,22:42692841:G:A,22:42692841:GC:G,22:42692843:C:A,22:42692847:T:G,22:42692849:C:T,22:42692850:C:T,22:42692854:T:G,22:42692857:G:C,22:42692858:G:A,22:42692860:G:A,22:42692866:T:G,22:42692872:G:A,22:42692879:T:C,22:42692879:T:G,22:42692881:G:A,22:42692882:C:T,22:42692883:G:A,22:42692884:G:A,22:42692886:C:T,22:42692888:C:T,22:42692891:C:T,22:42692896:G:A,22:42692899:C:T,22:42692900:A:C,22:42692903:T:G,22:42692905:C:T,22:42692906:A:G,22:42692907:T:C,22:42692911:C:T,22:42692913:C:G,22:42692913:C:T,22:42692914:G:A,22:42692917:C:A,22:42692917:C:T,22:42692918:G:A,22:42692918:G:C,22:42692920:C:T,22:42692921:G:T,22:42692924:G:A,22:42692929:G:A,22:42692930:T:C,22:42692932:G:A,22:42692933:C:T,22:42692934:G:A,22:42692935:G:A,22:42692937:C:T,22:42692940:G:A,22:42692948:G:A,22:42692950:C:G,22:42692953:C:T,22:42692954:A:G,22:42692954:AGTGCCCTGGACGTGGCCTCGAACCGC:A,22:42692957:G:A,22:42692961:T:C,22:42692963:G:T,22:42692965:C:T,22:42692966:G:A,22:42692967:T:C,22:42692968:G:A,22:42692971:C:G,22:42692974:G:A,22:42692976:A:G,22:42692977:C:T,22:42692978:C:G,22:42692978:C:T,22:42692979:G:A,22:42692980:C:A,22:42692980:C:T,22:42692981:G:A,22:42692985:C:T,22:42692990:C:T,22:42692991:T:G,22:42692995:C:G,22:42692995:C:T,22:42692998:G:T,22:42692999:T:C,22:42693006:C:T,22:42693007:G:A,22:42693012:C:T,22:42693015:C:T,22:42693016:A:G,22:42693017:T:C,22:42693019:G:A,22:42693022:G:A,22:42693023:G:T,22:42693025:A:G,22:42693028:G:A,22:42693029:A:G,22:42693031:C:G,22:42693032:A:G,22:42693035:C:T,22:42693036:G:A,22:42693037:C:T,22:42693038:G:A,22:42693038:G:C,22:42693048:C:T,22:42693049:G:A,22:42693049:G:C,22:42693049:G:T,22:42693050:G:A,22:42693060:C:A,22:42693063:C:T,22:42693064:A:G,22:42693069:A:G,22:42693069:A:T,22:42693070:C:T,22:42693071:T:C,22:42693077:C:T,22:42693079:G:C,22:42693081:C:A,22:42693081:C:T,22:42693083:T:C,22:42693086:C:G,22:42693089:G:C,22:42693094:G:A,22:42693096:G:A,22:42693096:G:C,22:42693103:G:A,22:42693110:G:A,22:42693111:G:C,22:42693115:C:A,22:42693115:C:T,22:42693119:G:A,22:42693126:C:T,22:42693126:CGCCGCGGCAGG:C,22:42693127:G:A,22:42693129:C:T,22:42693130:G:A,22:42693131:C:T,22:42693132:G:A,22:42693137:G:T,22:42693137:GCGCGGCT:G,22:42693138:C:T,22:42693139:G:A,22:42693139:G:T,22:42693140:C:T,22:42693141:G:A,22:42693141:G:C,22:42693147:C:T,22:42693148:G:A,22:42693152:A:G,22:42693158:C:G,22:42693158:C:T,22:42693159:G:A,22:42693159:G:C,22:42693161:A:T,22:42693169:C:G,22:42693170:C:T,22:42693171:ACTT:A,22:42693172:C:T,22:42693176:T:C,22:42693178:G:A,22:42693182:A:T,22:42693184:C:A,22:42693184:C:G,22:42693184:C:T,22:42693187:C:T,22:42693188:G:A,22:42693193:C:T,22:42693198:G:A,22:42693199:C:T,22:42693200:G:A,22:42693201:G:A,22:42693203:C:T,22:42693205:C:T,22:42693207:G:A,22:42693211:A:G,22:42693214:C:A,22:42693214:C:T,22:42693219:T:A,22:42693219:T:G,22:42693224:C:A,22:42693225:C:G,22:42693226:G:A,22:42693227:T:C,22:42693230:T:C,22:42693234:G:A,22:42693234:G:T,22:42693235:G:A,22:42693240:C:T,22:42693241:G:A,22:42693241:G:C,22:42693244:G:A,22:42693244:G:C,22:42693245:T:C,22:42693248:C:T,22:42693249:G:A,22:42693250:C:T,22:42693252:T:C,22:42693255:A:C,22:42693259:C:T,22:42693264:T:C,22:42693265:G:A,22:42693270:C:T,22:42693271:G:A,22:42693275:C:T,22:42693276:G:A,22:42693276:G:T,22:42693277:G:A,22:42693278:C:T,22:42693282:C:G,22:42693282:C:T,22:42693283:G:A,22:42693283:G:C,22:42693283:G:T,22:42693285:A:G,22:42693289:C:T,22:42693295:C:T,22:42693296:G:A,22:42693297:C:T,22:42693298:G:A,22:42693300:C:T,22:42693301:G:A,22:42693303:T:C,22:42693306:G:A,22:42693307:G:A,22:42693309:C:T,22:42693309:CG:C,22:42693310:G:A,22:42693310:G:T,22:42693310:GTA:G,22:42693314:C:T,22:42693315:G:A,22:42693322:G:C,22:42693323:G:A,22:42693328:C:T,22:42693332:A:C,22:42693334:G:A,22:42693335:T:C,22:42693340:C:G,22:42693342:G:T,22:42693345:T:C,22:42693347:C:T,22:42693348:G:A,22:42693348:G:T,22:42693357:T:C,22:42693360:G:A,22:42693364:A:G,22:42693366:T:A,22:42693366:T:C,22:42693369:A:G,22:42693373:C:T,22:42693374:G:A,22:42693375:T:C,22:42693378:C:T,22:42693381:G:A,22:42693383:T:TA,22:42693384:A:G,22:42693385:G:A,22:42693386:A:T,22:42693388:G:A,22:42693389:C:T,22:42693390:C:T,22:42693391:G:A,22:42693393:C:T,22:42693394:G:A,22:42693403:C:T,22:42693403:CAT:C,22:42693404:A:G,22:42693405:T:C,22:42693408:G:T,22:42693411:C:T,22:42693412:G:A,22:42693412:G:C,22:42693414:T:C,22:42693415:C:T,22:42693423:C:T,22:42693424:G:A,22:42693424:G:T,22:42693426:C:T,22:42693427:G:A,22:42693428:G:C,22:42693429:A:C,22:42693435:C:T,22:42693436:G:A,22:42693438:G:A,22:42693440:A:G,22:42693447:A:AG,22:42693449:G:A,22:42693458:C:T,22:42693459:G:A,22:42693460:C:G,22:42693464:T:C,22:42693465:G:A,22:42693466:C:G,22:42693468:C:T,22:42693469:G:A,22:42693469:G:C,22:42693472:C:T,22:42693473:G:A,22:42693474:C:T,22:42693475:G:A,22:42693475:G:C,22:42693478:C:T,22:42693480:A:AGTC,22:42693484:G:A,22:42693495:T:A,22:42693496:G:A,22:42693498:C:A,22:42693500:C:T,22:42693501:G:A,22:42693502:G:T,22:42693505:C:A,22:42693505:C:G,22:42693508:C:T,22:42693508:CTCCCGCA:C,22:42693511:C:T,22:42693512:C:T,22:42693513:G:A,22:42693516:G:A,22:42693516:G:C,22:42693517:G:A,22:42693517:G:C,22:42693517:GTCCAGCGGGA:G,22:42693520:CAGCGGG:C,22:42693523:C:T,22:42693524:G:A,22:42693526:G:A,22:42693528:G:GC,22:42693532:C:G,22:42693532:C:T,22:42693537:C:T,22:42693538:A:G,22:42693542:G:A,22:42693546:A:G,22:42693547:G:A,22:42693553:C:T,22:42693554:A:G,22:42693562:G:C,22:42693567:C:T,22:42693570:G:A,22:42693574:C:G,22:42693575:C:T,22:42693576:G:A,22:42693576:G:C,22:42693577:G:A,22:42693579:G:A,22:42693582:G:A,22:42693582:G:T,22:42693585:A:G,22:42693586:G:A,22:42693588:C:T,22:42693589:G:A,22:42693589:G:C,22:42693594:C:T,22:42693596:C:G,22:42693596:C:T,22:42693597:C:T,22:42693598:C:T,22:42693599:G:A,22:42693603:G:A,22:42693608:T:C,22:42693609:T:A,22:42693615:G:A,22:42693619:C:T,22:42693624:C:T,22:42693625:G:A,22:42693627:G:A,22:42693628:G:A,22:42693633:C:G,22:42693633:C:T,22:42693634:G:A,22:42693634:G:T,22:42693635:G:A,22:42693640:A:C,22:42693640:A:T,22:42693646:G:A,22:42693646:G:C,22:42693648:C:T,22:42693649:G:A,22:42693650:GC:G,22:42693652:C:A,22:42693652:C:G,22:42693653:G:A,22:42693654:AC:A,22:42693658:C:T,22:42693660:C:T,22:42693661:C:G,22:42693661:C:T,22:42693662:G:A,22:42693662:G:C,22:42693663:A:C,22:42693667:C:A,22:42693674:A:G,22:42693676:G:A,22:42693678:A:T,22:42693680:T:C,22:42693686:T:A,22:42693686:T:C,22:42693688:G:A,22:42693689:G:A,22:42693691:C:A,22:42693692:C:A,22:42693692:C:T,22:42693693:G:A,22:42693698:G:A,22:42693699:A:T,22:42693703:C:T,22:42693707:A:G,22:42693708:G:A,22:42693708:GGAA:G,22:42693709:G:T,22:42693712:G:T,22:42693714:A:G,22:42693714:A:T,22:42693717:T:A,22:42693717:T:C,22:42693721:G:A,22:42693726:G:C,22:42693729:T:C,22:42693733:GC:G,22:42693736:G:A,22:42693736:G:T,22:42693739:G:A,22:42693740:G:A,22:42693746:G:A,22:42693747:G:A,22:42693747:G:C,22:42693749:G:A,22:42693750:TGG:T,22:42693751:G:A,22:42693753:G:A,22:42693755:G:T,22:42693756:G:A,22:42693756:G:GT,22:42693756:G:T,22:42693759:T:A,22:42693760:C:T,22:42693764:G:T,22:42693766:G:A,22:42693771:A:C,22:42693771:AG:A,22:42693772:G:C,22:42693774:G:A,22:42693778:C:T,22:42693786:G:A,22:42693794:T:C,22:42693802:C:T,22:42693804:C:T,22:42693805:T:C,22:42693813:TG:T,22:42693814:G:A,22:42693814:G:C,22:42693819:C:T,22:42693823:C:G,22:42693823:C:T,22:42693823:CACA:C,22:42693827:A:G,22:42693828:C:T,22:42693829:G:A,22:42693835:G:A,22:42693838:G:A,22:42693843:T:C,22:42693845:A:G,22:42693848:G:C,22:42693850:G:A,22:42693852:C:G,22:42693852:C:T,22:42693853:G:A,22:42693855:A:G,22:42693859:C:T,22:42693860:G:A,22:42693868:G:A,22:42693873:C:T,22:42693873:CGAT:C,22:42693874:G:A,22:42693876:T:C,22:42693879:T:G,22:42693887:G:A,22:42693888:T:A,22:42693889:G:A,22:42693894:C:T,22:42693895:C:T,22:42693897:G:A,22:42693898:C:T,22:42693900:G:T,22:42693904:T:G,22:42693906:G:A,22:42693907:G:C,22:42693909:C:A,22:42693909:C:T,22:42693910:G:A,22:42693911:C:A,22:42693911:C:G,22:42693911:C:T,22:42693913:C:T,22:42693914:C:G,22:42693914:C:T,22:42693915:G:A,22:42693916:G:A,22:42693917:A:G,22:42693922:C:T,22:42693923:C:A,22:42693923:C:G,22:42693923:C:T,22:42693923:CGCA:C,22:42693924:G:A,22:42693924:G:T,22:42693933:G:A,22:42693936:C:G,22:42693936:C:T,22:42693937:G:A,22:42693937:G:C,22:42693938:G:C,22:42693939:G:A,22:42693941:G:T,22:42693942:G:A,22:42693945:T:G,22:42693947:G:A,22:42693950:A:G,22:42693953:G:GTAT,22:42693957:C:G,22:42693958:C:G,22:42693963:A:T,22:42693967:G:T,22:42693968:A:AC,22:42693969:C:G,22:42693969:C:T,22:42693973:G:A,22:42693974:A:G,22:42693986:G:C,22:42693989:C:T,22:42693990:C:T,22:42693991:G:A,22:42693991:G:C,22:42693993:C:T,22:42693996:G:A,22:42694011:G:A,22:42694014:C:G,22:42694016:C:T,22:42694017:G:A,22:42694017:G:C,22:42694022:C:T,22:42694029:G:A,22:42694031:C:T,22:42694032:G:A,22:42694033:T:C,22:42694034:T:C,22:42694036:G:A,22:42694037:C:T,22:42694042:C:G,22:42694043:C:A,22:42694043:C:T,22:42694044:G:A,22:42694044:G:C,22:42694046:T:C,22:42694048:C:T,22:42694049:A:C,22:42694050:C:T
Mask file¶
This file specifies which annotation categories should be combined into masks.
Each line contains a mask name followed by a comma-separated list of categories included in the mask (i.e. union is taken over categories).
head /home/student/USER/GWAS/data/regenie_WES_mask_file.txt | column -t
HIGH HIGH LOW LOW MODERATE MODERATE MODIFIER MODIFIER
Checking input files¶
To assess the concordance between the input files for building masks, we can use --check-burden-files which will generate a report in file_masks_report.txt containing:
for each set, the list the variants in the set-list file which are unrecognized (not genotyped or not present in annotation file for the set)
for each mask, the list of annotations in the mask definition file which are not in the annotation file
Additionally, we can use --strict-check-burden to enforce full agreement between the three files (if not, program will terminate) :
all genotyped variants in the set list file must be in the annotation file (for the corresponding set)
all annotations in the mask definition file must be present in the annotation file
source /home/student/miniconda3/bin/activate regenie_env
regenie \
--step 2 \
--bed /home/student/USER/GWAS/data/ukb23150_c22_2024_WES_1826 \
--ref-first \
--chr 22 \
--phenoFile /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt \
--bt \
--strict \
--firth --approx \
--bsize 1000 \
--pred /home/student/USER/GWAS/data/regenie_step1_WES_pred.list \
--check-burden-files \
--anno-file /home/student/USER/GWAS/data/regenie_WES_anno_file.txt \
--set-list /home/student/USER/GWAS/data/regenie_WES_set_list_CHR_POS.txt \
--mask-def /home/student/USER/GWAS/data/regenie_WES_mask_file.txt \
--skip-test \
--strict-check-burden \
--out ./output/burden_check_WES
conda deactivate
(regenie_env) Start time: Tue Jul 22 23:03:05 2025
|===========================|
| REGENIE v4.1.gz |
|===========================|
Copyright (c) 2020-2024 Joelle Mbatchou, Andrey Ziyatdinov and Jonathan Marchini.
Distributed under the MIT License.
Compiled with Boost Iostream library.
Using Intel MKL with Eigen.
Log of output saved in file : ./output/burden_check_WES.log
Options in effect:
--step 2 \
--bed /home/student/USER/GWAS/data/ukb23150_c22_2024_WES_1826 \
--ref-first \
--chr 22 \
--phenoFile /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt \
--bt \
--strict \
--firth \
--approx \
--bsize 1000 \
--pred /home/student/USER/GWAS/data/regenie_step1_WES_pred.list \
--check-burden-files \
--anno-file /home/student/USER/GWAS/data/regenie_WES_anno_file.txt \
--set-list /home/student/USER/GWAS/data/regenie_WES_set_list_CHR_POS.txt \
--mask-def /home/student/USER/GWAS/data/regenie_WES_mask_file.txt \
--strict-check-burden \
--out ./output/burden_check_WES
Association testing mode (joint tests) with fast multithreading using OpenMP
* bim : [/home/student/USER/GWAS/data/ukb23150_c22_2024_WES_1826.bim] n_snps = 605098
* fam : [/home/student/USER/GWAS/data/ukb23150_c22_2024_WES_1826.fam] n_samples = 1826
* bed : [/home/student/USER/GWAS/data/ukb23150_c22_2024_WES_1826.bed]
* phenotypes : [/home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt] n_pheno = 1
-dropping observations with missing values at any of the phenotypes
-number of phenotyped individuals with no missing data = 1826
* number of individuals used in analysis = 1826
* case-control counts for each trait:
- 'phenotype': 166 cases and 1660 controls
* LOCO predictions : [/home/student/USER/GWAS/data/regenie_step1_WES_pred.list]
-file [/home/student/USER/GWAS/data/regenie_step1_WES_1.loco] for phenotype 'phenotype'
* annotations : [/home/student/USER/GWAS/data/regenie_WES_anno_file.txt]
+number of annotations categories = 5
* masks : [/home/student/USER/GWAS/data/regenie_WES_mask_file.txt] n_masks = 4
* aaf cutoffs : [ 1 : 0.01 ] + singletons
* set file : [/home/student/USER/GWAS/data/regenie_WES_set_list_CHR_POS.txt] n_sets = 416
+report on burden input files written to [./output/burden_check_WES_masks_report.txt]
* # threads : [31]
* # tested sets : [416]
* max block size : [1000]
* rule used to build masks : max
* approximate memory usage : 171MB
* using minimum MAC of 5 (masks with lower MAC are ignored)
* using fast Firth correction for logistic/cox regression p-values less than 0.05
* user specified to test only on select chromosomes
Chromosome 22 [416 sets in total]
-reading loco predictions for the chromosome...done (0ms)
-fitting null logistic regression on binary phenotypes...done (0ms)
-fitting null Firth logistic regression on binary phenotypes...done (28ms)
set [1/416] : A4GALT - 571 variants...
-reading in genotypes and building masks...done (21ms)
-computing association tests...done (0ms)
set [2/416] : ACO2 - 848 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [3/416] : ACR - 802 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [4/416] : ADA2 - 1349 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [5/416] : ADM2 - 463 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [6/416] : ADORA2A - 566 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [7/416] : ADSL - 1347 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [8/416] : AIFM3 - 1195 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [9/416] : ALG12 - 2299 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [10/416] : ANKRD54 - 916 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [11/416] : AP1B1 - 2757 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [12/416] : APOBEC3A - 576 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [13/416] : APOBEC3B - 1075 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [14/416] : APOBEC3C - 1033 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [15/416] : APOBEC3D - 922 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [16/416] : APOBEC3F - 1272 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [17/416] : APOBEC3G - 1017 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [18/416] : APOBEC3H - 481 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [19/416] : APOL1 - 1124 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [20/416] : APOL2 - 1347 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [21/416] : APOL3 - 826 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [22/416] : APOL4 - 1048 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [23/416] : APOL5 - 711 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [24/416] : APOL6 - 535 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [25/416] : ARFGAP3 - 2279 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [26/416] : ARHGAP8 - 2353 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [27/416] : ARSA - 1113 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [28/416] : ARVCF - 1549 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [29/416] : ASCC2 - 1976 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [30/416] : ASPHD2 - 584 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [31/416] : ATP5MGL - 457 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [32/416] : ATP6V1E1 - 863 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [33/416] : ATXN10 - 1501 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [34/416] : BAIAP2L2 - 3513 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [35/416] : BCL2L13 - 1204 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [36/416] : BCR - 3379 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [37/416] : BID - 828 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [38/416] : BIK - 589 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [39/416] : BPIFC - 1799 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [40/416] : BRD1 - 2845 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [41/416] : C1QTNF6 - 763 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [42/416] : C22orf23 - 705 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [43/416] : C22orf31 - 804 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [44/416] : C22orf39 - 570 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [45/416] : C22orf42 - 999 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [46/416] : C22orf46 - 69 variants...
-reading in genotypes and building masks...done (0ms)
set [47/416] : CABIN1 - 4451 variants...
-reading in genotypes and building masks...done (8ms)
-computing association tests...done (0ms)
set [48/416] : CABP7 - 741 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [49/416] : CACNA1I - 5124 variants...
-reading in genotypes and building masks...done (10ms)
-computing association tests...done (0ms)
set [50/416] : CACNG2 - 576 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [51/416] : CARD10 - 2747 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [52/416] : CASTOR1 - 900 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [53/416] : CBX6 - 865 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [54/416] : CBX7 - 759 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [55/416] : CBY1 - 503 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [56/416] : CCDC116 - 438 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [57/416] : CCDC117 - 749 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [58/416] : CCDC134 - 777 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [59/416] : CCDC157 - 1005 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [60/416] : CCDC188 - 2164 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [61/416] : CCT8L2 - 670 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [62/416] : CDC42EP1 - 684 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [63/416] : CDC45 - 2729 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [64/416] : CDPF1 - 447 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [65/416] : CECR2 - 2824 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [66/416] : CELSR1 - 7118 variants...
-reading in genotypes and building masks...done (13ms)
-computing association tests...done (0ms)
set [67/416] : CENPM - 1040 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [68/416] : CERK - 1663 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [69/416] : CHADL - 1355 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [70/416] : CHCHD10 - 1243 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [71/416] : CHEK2 - 1303 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [72/416] : CHKB - 1235 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [73/416] : CLDN5 - 131 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [74/416] : CLTCL1 - 3901 variants...
-reading in genotypes and building masks...done (8ms)
-computing association tests...done (0ms)
set [75/416] : COMT - 2591 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [76/416] : CPT1B - 1903 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [77/416] : CRELD2 - 490 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [78/416] : CRKL - 458 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [79/416] : CRYBA4 - 675 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [80/416] : CRYBB1 - 614 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [81/416] : CRYBB2 - 560 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [82/416] : CRYBB3 - 578 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [83/416] : CSDC2 - 390 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [84/416] : CSF2RB - 1991 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [85/416] : CSNK1E - 1756 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [86/416] : CYB5R3 - 1271 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [87/416] : CYP2D6 - 1836 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [88/416] : CYTH4 - 1327 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [89/416] : DDT - 793 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [90/416] : DDX17 - 2132 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [91/416] : DENND6B - 2574 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [92/416] : DEPDC5 - 4207 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [93/416] : DERL3 - 1745 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [94/416] : DESI1 - 845 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [95/416] : DGCR2 - 1605 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [96/416] : DGCR6 - 138 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [97/416] : DGCR6L - 582 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [98/416] : DGCR8 - 2952 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [99/416] : DMC1 - 1002 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [100/416] : DNAL4 - 298 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [101/416] : DRG1 - 913 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [102/416] : DRICH1 - 1283 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [103/416] : DUSP18 - 255 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [104/416] : EFCAB6 - 3751 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [105/416] : EIF3D - 1370 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [106/416] : EIF3L - 1436 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [107/416] : EIF4ENIF1 - 2072 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [108/416] : ELFN2 - 1014 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [109/416] : EMID1 - 1759 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [110/416] : ENTHD1 - 846 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [111/416] : EP300 - 4930 variants...
-reading in genotypes and building masks...done (10ms)
-computing association tests...done (0ms)
set [112/416] : ESS2 - 2368 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [113/416] : EWSR1 - 1901 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [114/416] : FAM118A - 1404 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [115/416] : FAM227A - 1906 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [116/416] : FAM83F - 1022 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [117/416] : FBLN1 - 2655 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [118/416] : FBXO7 - 1310 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [119/416] : FOXRED2 - 1407 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [120/416] : GAB4 - 1417 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [121/416] : GAL3ST1 - 895 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [122/416] : GALR3 - 793 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [123/416] : GAS2L1 - 1172 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [124/416] : GCAT - 1561 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [125/416] : GGA1 - 2651 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [126/416] : GGT1 - 1537 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [127/416] : GGT2P - 46 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [128/416] : GGT5 - 1625 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [129/416] : GGTLC2 - 677 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [130/416] : GNAZ - 439 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [131/416] : GNB1L - 1127 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [132/416] : GP1BB - 1627 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [133/416] : GRAMD4 - 3758 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [134/416] : GRAP2 - 995 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [135/416] : GRK3 - 1922 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [136/416] : GSC2 - 331 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [137/416] : GSTT2 - 158 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [138/416] : GSTT2B - 309 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [139/416] : GTPBP1 - 1734 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [140/416] : GTSE1 - 1666 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [141/416] : GUCD1 - 642 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [142/416] : HDAC10 - 2239 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [143/416] : HDHD5 - 1369 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [144/416] : HIC2 - 786 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [145/416] : HIRA - 2950 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [146/416] : HMGXB4 - 1358 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [147/416] : HMOX1 - 717 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [148/416] : HORMAD2 - 860 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [149/416] : HPS4 - 1592 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [150/416] : HSCB - 758 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [151/416] : IFT27 - 801 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [152/416] : IGLC1 - 317 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [153/416] : IGLJ1 - 49 variants...
-reading in genotypes and building masks...done (0ms)
set [154/416] : IGLL1 - 550 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [155/416] : IGLL5 - 350 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [156/416] : IL17RA - 2191 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [157/416] : IL17REL - 1319 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [158/416] : IL2RB - 1341 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [159/416] : INPP5J - 1539 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [160/416] : ISX - 554 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [161/416] : JOSD1 - 622 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [162/416] : KCNJ4 - 419 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [163/416] : KCTD17 - 593 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [164/416] : KDELR3 - 1228 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [165/416] : KIAA0930 - 1680 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [166/416] : KIAA1671 - 2801 variants...
-reading in genotypes and building masks...done (9ms)
-computing association tests...done (0ms)
set [167/416] : KLHL22 - 946 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [168/416] : KREMEN1 - 2703 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [169/416] : L3MBTL2 - 2163 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [170/416] : LARGE1 - 2030 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [171/416] : LGALS1 - 503 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [172/416] : LGALS2 - 402 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [173/416] : LHFPL7 - 246 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [174/416] : LIF - 542 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [175/416] : LIMK2 - 1860 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [176/416] : LMF2 - 2601 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [177/416] : LRP5L - 31 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [178/416] : LRRC75B - 1082 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [179/416] : LZTR1 - 2367 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [180/416] : MAFF - 303 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [181/416] : MAPK1 - 809 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [182/416] : MAPK11 - 1214 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [183/416] : MAPK12 - 1774 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [184/416] : MAPK8IP2 - 1913 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [185/416] : MB - 389 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [186/416] : MCAT - 831 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [187/416] : MCHR1 - 748 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [188/416] : MCM5 - 1968 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [189/416] : MED15 - 2500 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [190/416] : MEI1 - 3415 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [191/416] : MFNG - 881 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [192/416] : MGAT3 - 643 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [193/416] : MICAL3 - 7134 variants...
-reading in genotypes and building masks...done (13ms)
-computing association tests...done (0ms)
set [194/416] : MICALL1 - 2009 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [195/416] : MIEF1 - 1482 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [196/416] : MIF - 511 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [197/416] : MIOX - 1070 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [198/416] : MIR3667HG - 827 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [199/416] : MLC1 - 1666 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [200/416] : MMP11 - 1202 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [201/416] : MN1 - 1639 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [202/416] : MORC2 - 2816 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [203/416] : MOV10L1 - 3658 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [204/416] : MPPED1 - 1439 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [205/416] : MPST - 497 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [206/416] : MRPL40 - 611 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [207/416] : MRTFA - 1936 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [208/416] : MTFP1 - 543 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [209/416] : MTMR3 - 2476 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [210/416] : MYH9 - 4773 variants...
-reading in genotypes and building masks...done (8ms)
-computing association tests...done (0ms)
set [211/416] : MYO18B - 5859 variants...
-reading in genotypes and building masks...done (10ms)
-computing association tests...done (0ms)
set [212/416] : NAGA - 1069 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [213/416] : NCAPH2 - 742 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [214/416] : NCF4 - 1158 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [215/416] : NDUFA6 - 206 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [216/416] : NEFH - 1563 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [217/416] : NF2 - 1828 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [218/416] : NFAM1 - 900 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [219/416] : NIPSNAP1 - 1061 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [220/416] : NOL12 - 1051 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [221/416] : NPTXR - 943 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [222/416] : NUP50 - 1223 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [223/416] : None - 4747 variants...
-reading in genotypes and building masks...done (10ms)
-computing association tests...done (0ms)
set [224/416] : OR11H1 - 304 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [225/416] : OSBP2 - 2630 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [226/416] : OSM - 570 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [227/416] : P2RX6 - 1256 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [228/416] : PACSIN2 - 1250 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [229/416] : PANX2 - 1187 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [230/416] : PARVB - 2101 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [231/416] : PARVG - 1589 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [232/416] : PATZ1 - 1622 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [233/416] : PDGFB - 927 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [234/416] : PDXP - 1189 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [235/416] : PES1 - 1535 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [236/416] : PEX26 - 814 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [237/416] : PHETA2 - 379 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [238/416] : PHF21B - 2012 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [239/416] : PHF5A - 483 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [240/416] : PI4KA - 6066 variants...
-reading in genotypes and building masks...done (14ms)
-computing association tests...done (0ms)
set [241/416] : PICK1 - 1436 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [242/416] : PIK3IP1 - 1402 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [243/416] : PIM3 - 1005 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [244/416] : PISD - 1565 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [245/416] : PITPNB - 1115 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [246/416] : PIWIL3 - 2256 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [247/416] : PKDREJ - 2107 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [248/416] : PLA2G3 - 1589 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [249/416] : PLA2G6 - 1915 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [250/416] : PLXNB2 - 4959 variants...
-reading in genotypes and building masks...done (9ms)
-computing association tests...done (1ms)
set [251/416] : PMM1 - 1151 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [252/416] : PNPLA3 - 1386 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [253/416] : PNPLA5 - 1493 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [254/416] : POLDIP3 - 1292 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [255/416] : POLR2F - 1136 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [256/416] : POLR3H - 2165 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [257/416] : POTEH - 666 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [258/416] : PPARA - 861 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [259/416] : PPIL2 - 2506 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [260/416] : PPM1F - 1272 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [261/416] : PPP6R2 - 2478 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [262/416] : PRAME - 1163 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [263/416] : PRODH - 59 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [264/416] : PRR14L - 2869 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [265/416] : PRR5 - 2484 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (8ms)
set [266/416] : PVALB - 500 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [267/416] : RAB36 - 999 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [268/416] : RABL2B - 636 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [269/416] : RAC2 - 683 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [270/416] : RANBP1 - 594 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [271/416] : RANGAP1 - 2283 variants...
-reading in genotypes and building masks...done (18ms)
-computing association tests...done (0ms)
set [272/416] : RASD2 - 404 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [273/416] : RASL10A - 532 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [274/416] : RBFOX2 - 1842 variants...
-reading in genotypes and building masks...done (9ms)
-computing association tests...done (0ms)
set [275/416] : RBX1 - 391 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [276/416] : RFPL1 - 462 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [277/416] : RFPL2 - 1045 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [278/416] : RFPL3 - 489 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [279/416] : RGL4 - 1537 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [280/416] : RHBDD3 - 1386 variants...
-reading in genotypes and building masks...done (12ms)
-computing association tests...done (0ms)
set [281/416] : RIBC2 - 1293 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [282/416] : RIMBP3 - 738 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [283/416] : RIMBP3B - 201 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [284/416] : RIMBP3C - 68 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [285/416] : RNF185 - 572 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [286/416] : RNF215 - 1484 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [287/416] : RPL3 - 1433 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [288/416] : RPS19BP1 - 565 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [289/416] : RRP7A - 988 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [290/416] : RSPH14 - 1405 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [291/416] : RTCB - 1345 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [292/416] : RTL10 - 2193 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [293/416] : RTL6 - 331 variants...
-reading in genotypes and building masks...done (0ms)
set [294/416] : RTN4R - 713 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [295/416] : SAMM50 - 1683 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [296/416] : SBF1 - 6041 variants...
-reading in genotypes and building masks...done (12ms)
-computing association tests...done (0ms)
set [297/416] : SCARF2 - 1762 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [298/416] : SCO2 - 3648 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [299/416] : SCUBE1 - 3063 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [300/416] : SDF2L1 - 514 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [301/416] : SEC14L2 - 1179 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [302/416] : SEC14L3 - 1771 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [303/416] : SEC14L4 - 1268 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [304/416] : SEC14L6 - 1264 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [305/416] : SELENOM - 622 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [306/416] : SELENOO - 2753 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [307/416] : SEPTIN3 - 430 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [308/416] : SEPTIN5 - 329 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [309/416] : SERHL2 - 1480 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [310/416] : SERPIND1 - 599 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [311/416] : SEZ6L - 2232 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [312/416] : SF3A1 - 1660 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [313/416] : SFI1 - 4541 variants...
-reading in genotypes and building masks...done (8ms)
-computing association tests...done (0ms)
set [314/416] : SGSM1 - 2960 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [315/416] : SGSM3 - 3292 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [316/416] : SH3BP1 - 1794 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [317/416] : SHANK3 - 3945 variants...
-reading in genotypes and building masks...done (10ms)
-computing association tests...done (0ms)
set [318/416] : SHISA8 - 1271 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [319/416] : SHISAL1 - 499 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [320/416] : SLC25A1 - 1073 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [321/416] : SLC25A17 - 923 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [322/416] : SLC25A18 - 1652 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (1ms)
set [323/416] : SLC2A11 - 1718 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [324/416] : SLC35E4 - 537 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [325/416] : SLC5A1 - 1722 variants...
-reading in genotypes and building masks...done (22ms)
-computing association tests...done (4ms)
set [326/416] : SLC5A4 - 1568 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [327/416] : SLC7A4 - 968 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [328/416] : SMARCB1 - 633 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [329/416] : SMC1B - 2023 variants...
-reading in genotypes and building masks...done (25ms)
-computing association tests...done (0ms)
set [330/416] : SMDT1 - 493 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [331/416] : SMTN - 2693 variants...
-reading in genotypes and building masks...done (32ms)
-computing association tests...done (0ms)
set [332/416] : SNAP29 - 722 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [333/416] : SNRPD3 - 845 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [334/416] : SNU13 - 1040 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [335/416] : SOX10 - 871 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [336/416] : SPECC1L - 2006 variants...
-reading in genotypes and building masks...done (55ms)
-computing association tests...done (9ms)
set [337/416] : SREBF2 - 2534 variants...
-reading in genotypes and building masks...done (69ms)
-computing association tests...done (8ms)
set [338/416] : SRRD - 1259 variants...
-reading in genotypes and building masks...done (10ms)
-computing association tests...done (0ms)
set [339/416] : SSTR3 - 1023 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [340/416] : ST13 - 1291 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [341/416] : SULT4A1 - 1341 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [342/416] : SUN2 - 2300 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [343/416] : SUSD2 - 2232 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [344/416] : SYCE3 - 1122 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [345/416] : SYN3 - 1337 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [346/416] : SYNGR1 - 1254 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [347/416] : TAB1 - 2717 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [348/416] : TAFA5 - 895 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [349/416] : TANGO2 - 893 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [350/416] : TBC1D10A - 1117 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [351/416] : TBC1D22A - 2251 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [352/416] : TBX1 - 1810 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [353/416] : TCF20 - 2337 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [354/416] : TCN2 - 1780 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [355/416] : TEF - 1252 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [356/416] : TEX33 - 702 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [357/416] : TFIP11 - 1577 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [358/416] : THAP7 - 1992 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [359/416] : THOC5 - 2050 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [360/416] : TIMP3 - 572 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [361/416] : TMEM121B - 910 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [362/416] : TMEM184B - 2251 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [363/416] : TMEM191B - 607 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [364/416] : TMEM191C - 807 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [365/416] : TMPRSS6 - 2996 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [366/416] : TNFRSF13C - 508 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [367/416] : TNRC6B - 3449 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [368/416] : TOB2 - 446 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [369/416] : TOM1 - 1487 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [370/416] : TOMM22 - 843 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [371/416] : TOP3B - 2388 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [372/416] : TPST2 - 900 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [373/416] : TRABD - 527 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [374/416] : TRIOBP - 4570 variants...
-reading in genotypes and building masks...done (13ms)
-computing association tests...done (0ms)
set [375/416] : TRMT2A - 2385 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [376/416] : TRMU - 1516 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [377/416] : TSPO - 499 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [378/416] : TST - 930 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [379/416] : TTC28 - 4067 variants...
-reading in genotypes and building masks...done (7ms)
-computing association tests...done (0ms)
set [380/416] : TTC38 - 1787 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [381/416] : TTLL1 - 1172 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [382/416] : TTLL12 - 2271 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [383/416] : TTLL8 - 2260 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [384/416] : TUBA8 - 824 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [385/416] : TUBGCP6 - 4294 variants...
-reading in genotypes and building masks...done (8ms)
-computing association tests...done (0ms)
set [386/416] : TXN2 - 596 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [387/416] : TXNRD2 - 2190 variants...
-reading in genotypes and building masks...done (6ms)
-computing association tests...done (0ms)
set [388/416] : TYMP - 754 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [389/416] : UBE2L3 - 1181 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [390/416] : UFD1 - 2260 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [391/416] : UPB1 - 1191 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [392/416] : UPK3A - 868 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [393/416] : UQCR10 - 226 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [394/416] : USP18 - 838 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [395/416] : USP41 - 762 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [396/416] : VPREB1 - 288 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [397/416] : VPREB3 - 254 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [398/416] : WBP2NL - 1656 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [399/416] : WNT7B - 2475 variants...
-reading in genotypes and building masks...done (5ms)
-computing association tests...done (0ms)
set [400/416] : XBP1 - 758 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [401/416] : XKR3 - 561 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [402/416] : XPNPEP3 - 1959 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [403/416] : XRCC6 - 1287 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
set [404/416] : YDJC - 965 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [405/416] : YPEL1 - 426 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [406/416] : YWHAH - 830 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [407/416] : YWHAH-AS1 - 357 variants...
-reading in genotypes and building masks...done (0ms)
-computing association tests...done (0ms)
set [408/416] : ZBED4 - 1178 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [409/416] : ZC3H7B - 2471 variants...
-reading in genotypes and building masks...done (4ms)
-computing association tests...done (0ms)
set [410/416] : ZDHHC8 - 1394 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [411/416] : ZMAT5 - 498 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [412/416] : ZNF280A - 641 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [413/416] : ZNF280B - 544 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [414/416] : ZNF70 - 534 variants...
-reading in genotypes and building masks...done (1ms)
-computing association tests...done (0ms)
set [415/416] : ZNF74 - 1018 variants...
-reading in genotypes and building masks...done (2ms)
-computing association tests...done (0ms)
set [416/416] : ZNRF3 - 1916 variants...
-reading in genotypes and building masks...done (3ms)
-computing association tests...done (0ms)
Association results stored separately for each trait in files :
* [./output/burden_check_WES_phenotype.regenie]
Number of tests with Firth correction : 77
Number of failed tests : (0/77)
Number of ignored tests due to low MAC : 0
Elapsed time : 3.21472s
End time: Tue Jul 22 23:03:08 2025
(regenie_env)
AAF file¶
Both functional annotations and alternative allele frequency (AAF) cutoffs are used when building masks (e.g. only considering LoF sites where AAF is below 1%).
By default, the AAF for each variant is computed from the sample but alternatively, the user can specify variant AAFs using this file.
AAF cutoffs¶
Option --aaf-bins specifies the AAF upper bounds used to generate burden masks (AAF and not MAF [minor allele frequency] is used when deciding which variants go into a mask).
By default, a mask based on singleton sites are always included.
For example, --aaf-bins 0.01,0.05 will generate 3 burden masks for AAFs in [0,0.01], [0,0.05] and singletons.
SKAT/ACAT tests¶
The option --vc-tests is used to specify the gene-based tests to run. By default, these tests use all variants in each mask category.
If you'd like to only include variants whose AAF is below a given threshold ,e.g. only including rare variants, you can use --vc-maxAAF.
For example, --vc-tests skato,acato-full will run SKATO and ACATO (both using the default grid of 8 rho values for the SKATO models) and the p-values for SKAT, SKATO, ACATV and ACATO will be output.
Ultra-rare variants (defined by default as MAC ≤ 10, see --vc-MACthr) are collapsed into a burden mask which is then included in the tests instead of the individual variants.
Joint test for burden masks¶
The ACAT test combines the p-values of the individual burden masks using the Cauchy combination method.
If you only want to output the results for the joint tests (ignore the marginal tests), use --joint-only.
source /home/student/miniconda3/bin/activate regenie_env
for chr in {1..22}; do
regenie \
--step 2 \
--bed /home/student/USER/GWAS/data/ukb23150_c${chr}_2024_WES_1826 \
--chr ${chr} \
--ref-first \
--phenoFile /home/student/USER/GWAS/data/covar_2024_WES_1826_phenotype.txt \
--bt \
--strict \
--firth --approx \
--bsize 1000 \
--pred /home/student/USER/GWAS/data/regenie_step1_WES_pred.list \
--check-burden-files \
--anno-file /home/student/USER/GWAS/data/regenie_WES_anno_file_chr${chr}.txt \
--set-list /home/student/USER/GWAS/data/regenie_WES_set_list_chr${chr}_CHR_POS.txt \
--mask-def /home/student/USER/GWAS/data/regenie_WES_mask_file.txt \
--rgc-gene-p \
--vc-tests skato,acato-full \
--joint acat,sbat \
--vc-MACthr 10 \
--out ./output/WES_gene_based_testing_chr${chr}
done
conda deactivate
For each set, this will produce masks using 3 AAF cutoffs (singletons, 5% and 10% AAF).
The masks are written to PLINK bed file (in _masks.{bed,bim,fam}) and tested for association with each trait (summary stats in _phenotype_name.regenie).
Additionally, a header line is included (starting with ##) which contains mask definition information.
Masks will have name set_name.mask_name.AAF_cutoff with the chromosome and physical position having been defined in the set list file, and the reference allele being ref, and the alternate allele corresponding to mask_name.AAF_cutoff.
When using --rgc-gene-p, it will apply the single p-value per gene GENE_P strategy using all masks.
View the result of REGENIE-GWAS¶
# combined the regenie results by chromosomes
awk 'FNR <= 2 && NR > 2 { next } { print }' \
./output/WES_gene_based_testing_chr*_phenotype.regenie \
> ./output/WES_gene_based_testing_all.regenie
head ./output/WES_gene_based_testing_all.regenie | column -t
##MASKS=<HIGH="HIGH";LOW="LOW";MODERATE="MODERATE";MODIFIER="MODIFIER"> CHROM GENPOS ID ALLELE0 ALLELE1 A1FREQ N TEST BETA SE CHISQ LOG10P EXTRA 22 42692793 A4GALT.LOW.0.001 ref LOW.0.001 0.00328587 1826 ADD -1.10206 1.2719 0.750761 0.413148 DF=1 22 42692793 A4GALT.LOW.0.01 ref LOW.0.01 NA 1826 ADD-ACATO NA NA 0.209014 0.188732 DF=1 22 42692793 A4GALT.LOW.0.01 ref LOW.0.01 NA 1826 ADD-ACATV NA NA 0.649733 0.376535 DF=1 22 42692793 A4GALT.LOW.0.01 ref LOW.0.01 NA 1826 ADD-SKAT NA NA 0.423444 0.288004 DF=1 22 42692793 A4GALT.LOW.0.01 ref LOW.0.01 NA 1826 ADD-SKATO NA NA 0.206585 0.187449 DF=1 22 42692793 A4GALT.LOW.0.01 ref LOW.0.01 NA 1826 ADD-SKATO-ACAT NA NA 0.180798 0.173479 DF=1 22 42692793 A4GALT.LOW.0.01 ref LOW.0.01 0.0106791 1826 ADD -0.0374441 0.626463 0.00357253 0.0212088 DF=1 22 42692793 A4GALT.MODERATE.singleton ref MODERATE.singleton 0.00465498 1826 ADD -1.18968 0.817397 2.11832 0.836999 DF=1
# search for the most significant gene
awk 'NR>1 {print $1,$2,$3,$12}' \
./output/WES_gene_based_testing_all.regenie | sort -k4,4gr 2>/dev/null | head -1 || true
22 29205939 EMID1.MODERATE.0.0001 3.03378
# Prepare for plotting the results
regenie_results= data.table::fread("./output/WES_gene_based_testing_all.regenie")
regenie_results[, P := 10^(-LOG10P)] %>%
data.table::setnames(
c("CHROM", "GENPOS", "ID"),
c("CHR", "BP", "SNP")
)
regenie_results %>%
data.table::fwrite("./output/WES_gene_based_testing_all_v2.regenie")
# running about 0.5 minutes
# Note: the alpha used here is 5e-8, but should be set as 0.05/N_genes!
options(repr.plot.width = 16,
repr.plot.height = 4,
repr.plot.res = 600)
source("/home/student/USER/GWAS/data/plotPlink.R")
# plot the results (.regenie is the output file from regenie)
plots= plot_qqman(
plink_assoc_file= "./output/WES_gene_based_testing_all_v2.regenie",
pheno_name= "CMT",
save_plot = FALSE,
lambda1_qq_pos = c(1.48, -5.5),
lambda2_qq_pos = c(1.1, -4)
)
print(plots$manhattan_plot)
# running about 0.5 minutes
options(repr.plot.width = 4.1,
repr.plot.height = 4.1,
repr.plot.res = 600)
print(plots$qq_plot)
Excercise F: Calculate GWAS power¶
Now we generate a statistical power analysis plot for GWAS studies.
Supports binary (case-control) traits over a range of odds ratios and minor allele frequencies, and quantitative traits over a range of effect sizes and minor allele frequencies.
Part1 : Quantitative traits¶
In our above example, standing height is the quantitative trait.
# calculate the standard deviation of the quantitative trait
import pandas as pd
df = pd.read_table(
'/home/student/USER/GWAS/data/European_1w_phenotypes.txt',
sep = '\\s+',
header = 0
)
print(df.shape)
df['Standing_height'].std(skipna=True)
(10000, 11)
np.float64(0.09365788681305078)
options(repr.plot.width = 16,
repr.plot.height = 8,
repr.plot.res = 600)
source("/home/student/USER/GWAS/data/plotPlink.R")
power_results_qt <- plot_gwas_power(
trait_type = "qt",
sd_trait = 0.09365788681305078,
N = 10000,
maf_levels = c(0.01, 0.02, 0.05, 0.10, 0.20, 0.50),
effect_size = seq(0.01, 0.10, 0.001),
save_plot = FALSE
)
print(power_results_qt$plot)
Part2: Binary traits¶
Now we generate a statistical power analysis plot for a given range of odds ratios and minor allele frequencies in a case-control GWAS study.
Statistical power is crucial for designing a successful GWAS.
It helps you determine the probability of detecting a true association, given a specific sample size, allele frequency, and effect size (Odds Ratio).
Example Usage¶
Let's run the example with a sample dataset:
Cases: 4,324
Controls: 93,945
Odds Ratios: Ranging from 1.01 to 2.00
MAF: 0.01, 0.02, 0.05, 0.10, 0.20, 0.50
options(repr.plot.width = 16,
repr.plot.height = 8,
repr.plot.res = 600)
source("/home/student/USER/GWAS/data/plotPlink.R")
power_results <- plot_gwas_power(
trait_type = "bt",
n_cases = 4324,
n_controls = 93945,
maf_levels = c(0.01, 0.02, 0.05, 0.10, 0.20, 0.50),
or_range = seq(1.01, 2.00, 0.01),
save_plot = FALSE
)
print(power_results$plot)